diff options
author | Alon Zakai <alonzakai@gmail.com> | 2015-11-02 17:41:27 -0800 |
---|---|---|
committer | Alon Zakai <alonzakai@gmail.com> | 2015-11-02 17:41:27 -0800 |
commit | ef4f2c7490600a0d868eb5a426a0617d055d8cb3 (patch) | |
tree | 64a9552a039b78ce87d855d8e155014794964da1 | |
parent | 786a3064b9f49b629067213e859714f35258dd99 (diff) | |
download | binaryen-ef4f2c7490600a0d868eb5a426a0617d055d8cb3.tar.gz binaryen-ef4f2c7490600a0d868eb5a426a0617d055d8cb3.tar.bz2 binaryen-ef4f2c7490600a0d868eb5a426a0617d055d8cb3.zip |
add fasta test
-rw-r--r-- | test/fasta.args | 1 | ||||
-rw-r--r-- | test/fasta.cpp | 198 | ||||
-rw-r--r-- | test/fasta.txt | 5 |
3 files changed, 204 insertions, 0 deletions
diff --git a/test/fasta.args b/test/fasta.args new file mode 100644 index 000000000..3d606956b --- /dev/null +++ b/test/fasta.args @@ -0,0 +1 @@ +["10"] diff --git a/test/fasta.cpp b/test/fasta.cpp new file mode 100644 index 000000000..1b52e1b27 --- /dev/null +++ b/test/fasta.cpp @@ -0,0 +1,198 @@ +/* The Computer Language Benchmarks Game + http://shootout.alioth.debian.org/ + contributed by Andrew Moon +*/ + +#include <stdio.h> +#include <stdlib.h> +#include <string.h> + +// limit output, so we do not benchmark speed of printing +void puts_limited(char *x) +{ + static int left = 550; + int len = strlen(x); + if (len <= left) { + puts(x); + left -= len; + return; + } + if (left > 0) { + x[left] = '\0'; + puts(x); + x[left] = 'z'; + left = 0; + } +} + +struct Random { + enum { IM = 139968, IA = 3877, IC = 29573 }; + Random() : last(42) {} + float get( float max = 1.0f ) { + last = ( last * IA + IC ) % IM; + return max * last / IM; + } +protected: + unsigned int last; +} rng; + +struct IUB { + int c; + double p; + unsigned int pi; +}; + +struct Cumulative { + enum { slots = 512, }; + + Cumulative( IUB *start ) { + double p = 0; + for ( IUB *iter = start; iter->c; ++iter ) { + p += iter->p; + iter->p = p < 1.0 ? p : 1.0; + iter->pi = (unsigned int )( iter->p * slots ); + } + + for ( unsigned int i = 0; i <= slots; i++ ) { + while ( i > start->pi && start->pi != 0) { + ++start; + } + + table[i] = start; + } + } + + const char operator[] ( float pct ) const { + IUB *iter = table[(unsigned int )( pct * slots )]; + while ( iter->p < pct ) + ++iter; + return iter->c; + } + +protected: + IUB *table[slots + 1]; +}; + +static const size_t lineLength = 60; + +struct LineBuffer { + LineBuffer() : lastN(0) {} + LineBuffer &genrand( Cumulative &table, size_t N ) { + //assert(N <= lineLength); + for ( size_t i = 0; i < N; i++ ) + buffer[i] = table[rng.get()]; + buffer[N] = '\n'; + buffer[N+1] = '\0'; + lastN = N + 1; + return *this; + } + void writeline() { puts_limited(buffer); } +protected: + char buffer[lineLength + 2]; + size_t lastN; +}; + +struct RotatingString { + RotatingString( const char *in ) : pos(0) { + size = strlen( in ); + buffer = new char[size + lineLength]; + memcpy( buffer, in, size ); + memcpy( buffer + size, in, lineLength ); + } + ~RotatingString() { delete[] buffer; } + void write( size_t bytes ) { + char* temp = new char[bytes+2]; + memcpy(temp, buffer + pos, bytes); + temp[bytes] = '\n'; + temp[bytes] = '\0'; + puts_limited(temp); + delete temp; + pos += bytes; + if ( pos > size ) + pos -= size; + } +protected: + char *buffer; + size_t size, pos; +}; + +template< class Output > +void makeFasta( const char *id, const char *desc, size_t N, Output &output ) { + while ( N ) { + const size_t bytes = N < lineLength ? N : lineLength; + output.writeline( bytes ); + N -= bytes; + } +} + +struct Repeater { + Repeater( const char *alu ) : rot(alu) {} + void writeline( size_t bytes ) { rot.write( bytes ); } + void run( const char *id, const char *desc, size_t N ) { + makeFasta( id, desc, N, *this ); + } +protected: + RotatingString rot; +}; + +struct Randomized { + Randomized( IUB *start ) : table(start) {} + void writeline( size_t bytes ) { line.genrand(table, bytes).writeline(); } + void run( const char *id, const char *desc, size_t N ) { + makeFasta( id, desc, N, *this ); + } +protected: + Cumulative table; + LineBuffer line; +}; + +IUB iub[] = { + { 'a', 0.27, 0 }, + { 'c', 0.12, 0 }, + { 'g', 0.12, 0 }, + { 't', 0.27, 0 }, + + { 'B', 0.02, 0 }, + { 'D', 0.02, 0 }, + { 'H', 0.02, 0 }, + { 'K', 0.02, 0 }, + { 'M', 0.02, 0 }, + { 'N', 0.02, 0 }, + { 'R', 0.02, 0 }, + { 'S', 0.02, 0 }, + { 'V', 0.02, 0 }, + { 'W', 0.02, 0 }, + { 'Y', 0.02, 0 }, + { 0, 0, 0 }, +}; + +IUB homosapiens[] = { + { 'a', 0.3029549426680, 0 }, + { 'c', 0.1979883004921, 0 }, + { 'g', 0.1975473066391, 0 }, + { 't', 0.3015094502008, 0 }, + { 0, 0, 0 }, +}; + +static const char alu[] = + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" + "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" + "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" + "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" + "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" + "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" + "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + +int main( int argc, const char *argv[] ) { + const size_t n = ( argc > 1 ) ? atoi( argv[1] ) : 512; + + Repeater(alu) + .run( "ONE", "Homo sapiens alu", n*2 ); + Randomized(iub) + .run( "TWO", "IUB ambiguity codes", n*3 ); + Randomized(homosapiens) + .run( "THREE", "Homo sapiens frequency", n*5 ); + + return 0; +} + diff --git a/test/fasta.txt b/test/fasta.txt new file mode 100644 index 000000000..c4f2c0647 --- /dev/null +++ b/test/fasta.txt @@ -0,0 +1,5 @@ +GGCCGGGCGCGGTGGCTCAC +cttBtatcatatgctaKggNcataaaSatg + +taaatcttgtgcttcgttagaagtctcgactacgtgtagcctagtgtttg + |