diff options
Diffstat (limited to 'test/fasta.cpp')
-rw-r--r-- | test/fasta.cpp | 263 |
1 files changed, 132 insertions, 131 deletions
diff --git a/test/fasta.cpp b/test/fasta.cpp index 1b52e1b27..4216665ea 100644 --- a/test/fasta.cpp +++ b/test/fasta.cpp @@ -8,8 +8,7 @@ #include <string.h> // limit output, so we do not benchmark speed of printing -void puts_limited(char *x) -{ +void puts_limited(char* x) { static int left = 550; int len = strlen(x); if (len <= left) { @@ -26,173 +25,175 @@ void puts_limited(char *x) } struct Random { - enum { IM = 139968, IA = 3877, IC = 29573 }; - Random() : last(42) {} - float get( float max = 1.0f ) { - last = ( last * IA + IC ) % IM; - return max * last / IM; - } + enum { IM = 139968, IA = 3877, IC = 29573 }; + Random() : last(42) {} + float get(float max = 1.0f) { + last = (last * IA + IC) % IM; + return max * last / IM; + } + protected: - unsigned int last; + unsigned int last; } rng; struct IUB { - int c; - double p; - unsigned int pi; + int c; + double p; + unsigned int pi; }; struct Cumulative { - enum { slots = 512, }; - - Cumulative( IUB *start ) { - double p = 0; - for ( IUB *iter = start; iter->c; ++iter ) { - p += iter->p; - iter->p = p < 1.0 ? p : 1.0; - iter->pi = (unsigned int )( iter->p * slots ); + enum { + slots = 512, + }; + + Cumulative(IUB* start) { + double p = 0; + for (IUB* iter = start; iter->c; ++iter) { + p += iter->p; + iter->p = p < 1.0 ? p : 1.0; + iter->pi = (unsigned int)(iter->p * slots); + } + + for (unsigned int i = 0; i <= slots; i++) { + while (i > start->pi && start->pi != 0) { + ++start; } - for ( unsigned int i = 0; i <= slots; i++ ) { - while ( i > start->pi && start->pi != 0) { - ++start; - } - - table[i] = start; - } - } + table[i] = start; + } + } - const char operator[] ( float pct ) const { - IUB *iter = table[(unsigned int )( pct * slots )]; - while ( iter->p < pct ) - ++iter; - return iter->c; - } + const char operator[](float pct) const { + IUB* iter = table[(unsigned int)(pct * slots)]; + while (iter->p < pct) + ++iter; + return iter->c; + } protected: - IUB *table[slots + 1]; + IUB* table[slots + 1]; }; static const size_t lineLength = 60; struct LineBuffer { - LineBuffer() : lastN(0) {} - LineBuffer &genrand( Cumulative &table, size_t N ) { - //assert(N <= lineLength); - for ( size_t i = 0; i < N; i++ ) - buffer[i] = table[rng.get()]; - buffer[N] = '\n'; - buffer[N+1] = '\0'; - lastN = N + 1; - return *this; - } - void writeline() { puts_limited(buffer); } + LineBuffer() : lastN(0) {} + LineBuffer& genrand(Cumulative& table, size_t N) { + // assert(N <= lineLength); + for (size_t i = 0; i < N; i++) + buffer[i] = table[rng.get()]; + buffer[N] = '\n'; + buffer[N + 1] = '\0'; + lastN = N + 1; + return *this; + } + void writeline() { puts_limited(buffer); } + protected: - char buffer[lineLength + 2]; - size_t lastN; + char buffer[lineLength + 2]; + size_t lastN; }; struct RotatingString { - RotatingString( const char *in ) : pos(0) { - size = strlen( in ); - buffer = new char[size + lineLength]; - memcpy( buffer, in, size ); - memcpy( buffer + size, in, lineLength ); - } - ~RotatingString() { delete[] buffer; } - void write( size_t bytes ) { - char* temp = new char[bytes+2]; - memcpy(temp, buffer + pos, bytes); - temp[bytes] = '\n'; - temp[bytes] = '\0'; - puts_limited(temp); - delete temp; - pos += bytes; - if ( pos > size ) - pos -= size; - } + RotatingString(const char* in) : pos(0) { + size = strlen(in); + buffer = new char[size + lineLength]; + memcpy(buffer, in, size); + memcpy(buffer + size, in, lineLength); + } + ~RotatingString() { delete[] buffer; } + void write(size_t bytes) { + char* temp = new char[bytes + 2]; + memcpy(temp, buffer + pos, bytes); + temp[bytes] = '\n'; + temp[bytes] = '\0'; + puts_limited(temp); + delete temp; + pos += bytes; + if (pos > size) + pos -= size; + } + protected: - char *buffer; - size_t size, pos; + char* buffer; + size_t size, pos; }; -template< class Output > -void makeFasta( const char *id, const char *desc, size_t N, Output &output ) { - while ( N ) { - const size_t bytes = N < lineLength ? N : lineLength; - output.writeline( bytes ); - N -= bytes; - } +template<class Output> +void makeFasta(const char* id, const char* desc, size_t N, Output& output) { + while (N) { + const size_t bytes = N < lineLength ? N : lineLength; + output.writeline(bytes); + N -= bytes; + } } struct Repeater { - Repeater( const char *alu ) : rot(alu) {} - void writeline( size_t bytes ) { rot.write( bytes ); } - void run( const char *id, const char *desc, size_t N ) { - makeFasta( id, desc, N, *this ); - } + Repeater(const char* alu) : rot(alu) {} + void writeline(size_t bytes) { rot.write(bytes); } + void run(const char* id, const char* desc, size_t N) { + makeFasta(id, desc, N, *this); + } + protected: - RotatingString rot; + RotatingString rot; }; struct Randomized { - Randomized( IUB *start ) : table(start) {} - void writeline( size_t bytes ) { line.genrand(table, bytes).writeline(); } - void run( const char *id, const char *desc, size_t N ) { - makeFasta( id, desc, N, *this ); - } + Randomized(IUB* start) : table(start) {} + void writeline(size_t bytes) { line.genrand(table, bytes).writeline(); } + void run(const char* id, const char* desc, size_t N) { + makeFasta(id, desc, N, *this); + } + protected: - Cumulative table; - LineBuffer line; + Cumulative table; + LineBuffer line; }; IUB iub[] = { - { 'a', 0.27, 0 }, - { 'c', 0.12, 0 }, - { 'g', 0.12, 0 }, - { 't', 0.27, 0 }, - - { 'B', 0.02, 0 }, - { 'D', 0.02, 0 }, - { 'H', 0.02, 0 }, - { 'K', 0.02, 0 }, - { 'M', 0.02, 0 }, - { 'N', 0.02, 0 }, - { 'R', 0.02, 0 }, - { 'S', 0.02, 0 }, - { 'V', 0.02, 0 }, - { 'W', 0.02, 0 }, - { 'Y', 0.02, 0 }, - { 0, 0, 0 }, + {'a', 0.27, 0}, + {'c', 0.12, 0}, + {'g', 0.12, 0}, + {'t', 0.27, 0}, + + {'B', 0.02, 0}, + {'D', 0.02, 0}, + {'H', 0.02, 0}, + {'K', 0.02, 0}, + {'M', 0.02, 0}, + {'N', 0.02, 0}, + {'R', 0.02, 0}, + {'S', 0.02, 0}, + {'V', 0.02, 0}, + {'W', 0.02, 0}, + {'Y', 0.02, 0}, + {0, 0, 0}, }; IUB homosapiens[] = { - { 'a', 0.3029549426680, 0 }, - { 'c', 0.1979883004921, 0 }, - { 'g', 0.1975473066391, 0 }, - { 't', 0.3015094502008, 0 }, - { 0, 0, 0 }, + {'a', 0.3029549426680, 0}, + {'c', 0.1979883004921, 0}, + {'g', 0.1975473066391, 0}, + {'t', 0.3015094502008, 0}, + {0, 0, 0}, }; -static const char alu[] = - "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" - "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" - "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" - "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" - "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" - "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" - "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; - -int main( int argc, const char *argv[] ) { - const size_t n = ( argc > 1 ) ? atoi( argv[1] ) : 512; - - Repeater(alu) - .run( "ONE", "Homo sapiens alu", n*2 ); - Randomized(iub) - .run( "TWO", "IUB ambiguity codes", n*3 ); - Randomized(homosapiens) - .run( "THREE", "Homo sapiens frequency", n*5 ); - - return 0; -} +static const char alu[] = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG" + "GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA" + "GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA" + "AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT" + "CCCAGCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAAC" + "CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG" + "CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + +int main(int argc, const char* argv[]) { + const size_t n = (argc > 1) ? atoi(argv[1]) : 512; + Repeater(alu).run("ONE", "Homo sapiens alu", n * 2); + Randomized(iub).run("TWO", "IUB ambiguity codes", n * 3); + Randomized(homosapiens).run("THREE", "Homo sapiens frequency", n * 5); + + return 0; +} |